Prev. |  KEGG KO K04671 > 

RIKEN DNA Bank Human Resource - BMPR2

Gene ID NCBI Gene 659 |  KEGG hsa:659
Gene Symbol BMPR2
Protein Name bone morphogenetic protein receptor type 2
Synonyms BMPR-II|BMPR3|BMR2|BRK-3|POVD1|PPH1|T-ALK
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  BMPR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010510 IRAK026E14 pCMV-SPORT6 BC032011 NM_001204
HGY029319 IRAK073E23 pBluescriptR BC035097 NM_001204 Partial/var
HGY030259 IRAK075K19 pBluescriptR BC043650 NM_001204 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378521 RBd46F01 pGCAP10 NM_001204.5 VA done
GGCGACTCCCCCCTTTGTGTCTGGTCTGCTCGGAGCCACTGGAAGTGCCTCCCGGAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl