Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BLVRB

Gene ID (NCBI) 645
Gene Symbol BLVRB
Protein Name biliverdin reductase B
Synonyms BVRB|FLR|HEL-S-10|SDR43U1
Databases KEGG hsa:645 |  NCBI Gene 645
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05901)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061205 ARe53A05 pKA1U5 NM_000713.2  
GAGCAGCCAGTGGGTTTCCCGCGCGTGCCGAGACTCTGAGGCCTTGCACCCCCACGATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl