RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - BLVRB

Gene ID	NCBI Gene 645 \| KEGG hsa:645
Gene Symbol	BLVRB
Protein Name	biliverdin reductase B
Synonyms	BVRB\|FLR\|HEL-S-10\|SDR43U1

Ortholog resource in our bank

  BLVRB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR061205	ARe53A05	pKA1U5	NM_000713.2	Full
HKR061205	GAGCAGCCAGTGGGTTTCCCGCGCGTGCCGAGACTCTGAGGCCTTGCACCCCCACGATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl