Prev. |  KEGG KO K00214 > 

RIKEN DNA Bank Human Resource - BLVRA

Gene ID NCBI Gene 644 |  KEGG hsa:644
Gene Symbol BLVRA
Protein Name biliverdin reductase A
Synonyms BLVR|BVR|BVRA
Ortholog resource in our bank

  BLVRA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088410 IRAL021A10 pDNR-LIB BC008456 NM_000712 Full
HGY088716 IRAL021N04 pDNR-LIB BC005902 NM_000712 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096435 M01C041B11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096483 M01C041D11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096531 M01C041F11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096579 M01C041H11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096627 M01C041J11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096675 M01C041L11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096723 M01C041N11 pDONR221 MGC10-C06 BC005902 NM_000712  
HGE096771 M01C041P11 pDONR221 MGC10-C06 BC005902 NM_000712  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082573 ARf06H05 pKA1U5 NM_000712.3  
GGCCCGGAGGCTGCACGGAGAGCGGTGCCCGCGCTCAGTTGACCGAAGGAAGAGACCAAG
HKR179678 ARi49D06 pGCAP10 NM_000712.3  
GGGTCCGCAAAGCCGGTGGCGCCCGGAGGCTGCACGGAGAGCGGTGCCCGCGTCAGTGAC
HKR179681 ARi49D09 pGCAP10 NM_000712.3  
GGGTCCGCAAAGCCGGTGGCGCCCGGAGGCTGCACGGAGAGCGGTGCCCGCGTCAGTGAC
HKR247240 ARiS118B16 pGCAP10 NM_000712.3  
GCCGCAAAGCCTGTGGCGCCCGGAGGCTGCACGGAGAGCGGTGCCCGCGTCAGTGACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl