Prev. |  KEGG KO K18739 > 

RIKEN DNA Bank Human Resource - BICD1

Gene ID NCBI Gene 636 |  KEGG hsa:636
Gene Symbol BICD1
Protein Name BICD cargo adaptor 1
Synonyms BICD|bic-D 1
Ortholog resource in our bank

  BICD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069379 ARe73H11 pKA1U5 NM_001714.2 Full done
GAGAGGGAGCAGGTGGAGCGAGAGAGCGAGCCGCCTTTNCGGAGCGCGCCAGACCCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl