Prev. |  KEGG KO K00019 > 

RIKEN DNA Bank Human Resource - BDH1

Gene ID NCBI Gene 622 |  KEGG hsa:622
Gene Symbol BDH1
Protein Name 3-hydroxybutyrate dehydrogenase 1
Synonyms BDH|SDR9C1
Ortholog resources KEGG ortholog (KEGG orthology K00019) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008439 IRAK021B15 pCMV-SPORT6 BC011964 NM_203315 Full/var
HGY080969 IRAL002H01 pOTB7 BC005844 NM_203315 Full
HGY083827 IRAL009J11 pOTB7 BC019317 NM_203315 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362150 RBd05G06 pGCAP10 NM_004051.4  
GGTGTAGAAGCGTCCGGGTGGCGGAGGCCGCAGGCCGCAGGAGTGCTGGTGGAGGGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl