Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BCYRN1

Gene ID (NCBI) 618
Gene Symbol BCYRN1
Protein Name brain cytoplasmic RNA 1
Synonyms BC200|BC200a|LINC00004|NCRNA00004
Databases KEGG hsa:618 |  NCBI Gene 618


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR069754 ARe74G10 pKA1U5 NR_001568.1  
TGGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTTCTCAGGGAGGCTAAGAGGCGGG
HKR080434 ARf01B10 pKA1U5 NR_001568.1  
TGGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGA
HKR342903 RBb57E07 pGCAP1 NR_001568.1  
GCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGG
HKR461709 RBdS154E13 pGCAP10 NR_001568.1  
AAATGGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCG
HKR470829 RBdS177B05 pGCAP10 NR_001568.1  
TGGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGA
HKR470904 RBdS177E08 pGCAP10 NR_001568.1  
GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl