Prev. |  KEGG KO K08900 > 

RIKEN DNA Bank Human Resource - BCS1L

Gene ID NCBI Gene 617 |  KEGG hsa:617
Gene Symbol BCS1L
Protein Name BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone
Synonyms BCS|BCS1|BJS|FLNMS|GRACILE|Hs.6719|MC3DN1|PTD|h-BCS|h-BCS1
Ortholog resources KEGG ortholog (KEGG orthology K08900) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080710 IRAL001M22 pOTB7 BC000416 NM_004328 Full
HGY084029 IRAL010B05 pOTB7 BC007500 NM_004328 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037910 W01A094M22 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037938 W01A094O02 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037940 W01A094O04 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037942 W01A094O06 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037946 W01A094O10 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037948 W01A094O12 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037952 W01A094O16 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037954 W01A094O18 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE037956 W01A094O20 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE046949 W01A117G05 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE046951 W01A117G07 pENTR-TOPO IRAL001M22 BC000416 NM_004328  
HGE046955 W01A117G11 pENTR-TOPO IRAL001M22 BC000416 NM_004328  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071634 ARe79B10 pKA1U5 NM_004328.4  
GACGGAGGGCCAGAGAGTCACGGCGGTTTTCGTAACACCCCAGGGCCTGTAAGGTTTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl