Prev. |  KEGG KO K08878 > 

RIKEN DNA Bank Human Resource - BCR

Gene ID NCBI Gene 613 |  KEGG hsa:613
Gene Symbol BCR
Protein Name BCR, RhoGEF and GTPase activating protein
Synonyms ALL|BCR1|CML|D22S11|D22S662|PHL
Ortholog resources KEGG ortholog (KEGG orthology K08878) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033656 IRAK084C08 pCMV-SPORT6 BC041705 NM_021574 Partial/var
HGX046047 IRAK115B23 pCMV-SPORT6 BC053641 NM_021574
HGY053341 IRAK133F21 pBluescript BC066122 NM_004327 Full/var
HGX053645 IRAK134B21 pCMV-SPORT6 BC063619 NM_021574 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088404 M01C021A04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088452 M01C021C04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088500 M01C021E04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088548 M01C021G04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088596 M01C021I04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088644 M01C021K04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088692 M01C021M04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088740 M01C021O04 pDONR221 IMS03-B02 BC066122 NM_004327  
HGE088427 M01C021B03 pDONR221 IMS03-C02 BC066122 NM_004327  
HGE088475 M01C021D03 pDONR221 IMS03-C02 BC066122 NM_004327  
HGE088523 M01C021F03 pDONR221 IMS03-C02 BC066122 NM_004327  
HGE088571 M01C021H03 pDONR221 IMS03-C02 BC066122 NM_004327  
HGE088435 M01C021B11 pDONR221 IMS03-C06 BC066122 NM_004327  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040403 W01A101A03 pENTR-TOPO flj0076h01 AK128501 NM_021574  
HGE040421 W01A101A21 pENTR-TOPO flj0076h01 AK128501 NM_021574  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR394506 RBd86E10 pGCAP10 NM_004327.3  
GGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl