Prev. | 

RIKEN DNA Bank Human Resource - BCL7A

Gene ID NCBI Gene 605 |  KEGG hsa:605
Gene Symbol BCL7A
Protein Name BAF chromatin remodeling complex subunit BCL7A
Synonyms BCL7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163655 ARi09C07 pGCAP10 NM_020993.3 VA done
GGAGTGAGTGAGCGGCGGGCGGGCGCGAGTGTGGCCGCCGCGGAGCGCGAGCAGGACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl