Prev. |  KEGG KO K15618 > 

RIKEN DNA Bank Human Resource - BCL6

Gene ID NCBI Gene 604 |  KEGG hsa:604
Gene Symbol BCL6
Protein Name BCL6 transcription repressor
Synonyms BCL5|BCL6A|LAZ3|ZBTB27|ZNF51
Ortholog resource in our bank

  BCL6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162430 ARi06B06 pGCAP10 NM_001706.3 VA done
GAGAAGTGGTGATGCAAGAAGTTTCTAGGAAAGGCCGGACACCAGGTTTTGAGCAAAATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl