Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BCL6

Gene ID (NCBI) 604
Gene Symbol BCL6
Protein Name B-cell CLL/lymphoma 6
Synonyms BCL5|BCL6A|LAZ3|ZBTB27|ZNF51
Databases KEGG hsa:604 |  NCBI Gene 604
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15618)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162430 ARi06B06 pGCAP10 NM_001706.3 done
GAGAAGTGGTGATGCAAGAAGTTTCTAGGAAAGGCCGGACACCAGGTTTTGAGCAAAATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl