Prev. |  KEGG KO K04503 > 

RIKEN DNA Bank Human Resource - CCND1

Gene ID NCBI Gene 595 |  KEGG hsa:595
Gene Symbol CCND1
Protein Name cyclin D1
Synonyms BCL1|D11S287E|PRAD1|U21B31
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Ortholog resource in our bank

  CCND1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07299 pGL4-phCCND1 Promoter collection, Human CCND1 promoter
RDB07969 pBabePuro-Cyclin D1a Retroviral vector of human Cyclin D1a
RDB07970 pBabePuro-Cyclin D1b Retroviral vector of human Cyclin D1b
RDB07971 pBabePuro-Cyclin D1-T286A Retroviral vector of human Cyclin D1a mutant

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083014 IRAL007I22 pOTB7 BC000076 NM_053056 Full
HGY083104 IRAL007M16 pOTB7 BC001501 NM_053056 Full
HGY091438 IRAL028J22 pOTB7 BC014078 NM_053056 Full
HGY093388 IRAL033H20 pOTB7 BC023620 NM_053056 Full
HGY097174 IRAL042P14 pOTB7 BC025302 NM_053056 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073206 ARe83A06 pKA1U5 NM_053056.2  
GAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCA
HKR166931 ARi17F11 pGCAP10 NM_053056.2  
GAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCA
HKR174504 ARi36E08 pGCAP10 NM_053056.2  
GAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCA
HKR185276 ARi63D04 pGCAP10 NM_053056.2  
GAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCA
HKR209252 ARiS023C04 pGCAP10 NM_053056.2  
GAGAGGGCTGTCGGCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl