Prev. |  KEGG KO K00166 > 

RIKEN DNA Bank Human Resource - BCKDHA

Gene ID NCBI Gene 593 |  KEGG hsa:593
Gene Symbol BCKDHA
Protein Name branched chain keto acid dehydrogenase E1, alpha polypeptide
Synonyms BCKDE1A|MSU|MSUD1|OVD1A
Ortholog resources KEGG ortholog (KEGG orthology K00166) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080925 IRAL002F05 pOTB7 BC008933 NM_000709 Full
HGY088035 IRAL020B11 pOTB7 BC007878 NM_000709 Full
HGY093180 IRAL032P20 pDNR-LIB BC023983 NM_000709 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065700 ARe64E04 pKA1U5 NM_000709.2  
ATCCTGGGTTGTTAGCCAAGATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAA
HKR326528 RBb16F08 pKA1U5 NM_000709.2  
GGTTAGCCAAGATGGCGGTAGCGATCGCTGCACCTTNGGTCTGGCGGCTAAACCGTGGTT
HKR373303 RBd33E07 pGCAP10 NM_000709.2  
GGTTAGCCAAGATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAAACCGTGGTT
HKR390884 RBd77D12 pGCAP10 NM_000709.2  
GGTTAGCCAAGATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAAACCGTGGTT
HKR398921 RBd97F01 pGCAP10 NM_000709.2  
GGTTGTTAGCCAAGATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAAACCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl