Prev. |  KEGG KO K00826 > 

RIKEN DNA Bank Human Resource - BCAT1

Gene ID NCBI Gene 586 |  KEGG hsa:586
Gene Symbol BCAT1
Protein Name branched chain amino acid transaminase 1
Synonyms BCATC|BCT1|ECA39|MECA39|PNAS121|PP18
Ortholog resources KEGG ortholog (KEGG orthology K00826) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027476 IRAK068L12 pCMV-SPORT6 BC033864 NM_005504 Partial
HGY095465 IRAL038L01 pDNR-LIB BC026006 NM_005504

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010331 W01A025N19 pENTR-TOPO IRAK068L12 BC033864 NM_005504  
HGE010333 W01A025N21 pENTR-TOPO IRAK068L12 BC033864 NM_005504  
HGE010335 W01A025N23 pENTR-TOPO IRAK068L12 BC033864 NM_005504  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046906 ARe17E10 pKA1U5 NM_005504.5  
GGCGCTCTGCAGCCGCAGACCCGGTCCACACGGCCAGGGGCTACGACCCTTGGGATCTGC
HKR056131 ARe40F11 pKA1U5 NM_005504.5  
GAGACCCGGTCCACACGGNCAGGGGCTACGACCCCTTNAANNGGCCCTCCGATCAGNGCG
HKR247406 ARiS118I14 pGCAP10 NM_005504.5  
HKR379724 RBd49F04 pGCAP10 NM_005504.5  
GGTGTACTCGCCGCCGCCTCGGGCACTGCCCCAGGTCTTGCTGCAGCCGGGACCGCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl