Prev. |  KEGG KO K16747 > 

RIKEN DNA Bank Human Resource - BBS2

Gene ID NCBI Gene 583 |  KEGG hsa:583
Gene Symbol BBS2
Protein Name Bardet-Biedl syndrome 2
Synonyms BBS|RP74
Ortholog resource in our bank

  BBS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092347 IRAL030O11 pOTB7 BC014140 NM_031885 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171756 ARi29G12 pGCAP10 NM_031885.3  
GAGGCGGTACCTGGACGGGTTCGTCCCGGGCTGTTTCGCGTCCGGCCTGAGGCGGCTGGN
HKR381660 RBd54C12 pGCAP10 NM_031885.3  
GACGGGTCCTGCGCCGCCGCAGGAGGAGCAGGCGGTACCTGNNANNNNNTTCGTCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl