Prev. |  KEGG KO K02158 > 

RIKEN DNA Bank Human Resource - BAD

Gene ID NCBI Gene 572 |  KEGG hsa:572
Gene Symbol BAD
Protein Name BCL2 associated agonist of cell death
Synonyms BBC2|BCL2L8
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Ortholog resource in our bank

  BAD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03488 pAxCALNLhBAD (forward) Shuttle vector to generate rAd harboring human BAD (forward)
RDB04073 pAxCALNLhBAD (reverse) Shuttle vector to generate rAd harboring human BAD (reverse)
RDB05145 pAxCALNLhBAD (forward) Shuttle vector to generate rAd harboring human BAD (forward)
RDB05148 pAxCALNLhBAD (forward) Shuttle vector to generate rAd harboring human BAD (forward)
RDB06605 pCMFlag_hsBAD Expression vector of human BAD.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083385 IRAL008H17 pOTB7 BC001901 NM_032989 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061608 ARe54A08 pKA1U5 NM_004322.3  
GGGAGCCCGGGGTTGCTGGAGGGANGCGGCAGGCCCGGGTCAGGGGCCTCNAGATCGGGC
HKR071755 ARe79G11 pKA1U5 NM_004322.3  
GAGGGAGGCGGCAGGCCCGGGTCAGGGGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTT
HKR186010 ARi65A10 pGCAP10 NM_004322.3  
GAGGCCCGGGTCAGGGGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCAG
HKR276677 ARiS191L13 pGCAP10 NM_004322.3  
GNNNNNNNNNNGNGNCCGGAGCCCGGGGTGCTGGAGGGAGGCGGCAGGCCCGGGTCAGGG
HKR329322 RBb23F02 pGCAP1 NM_004322.3  
GCCTCAGGCCGCTGATGGGAGAGCCGGCTCAGGTCGTGGGGACCCGGGGCTCCGGCTCCC
HKR343772 RBb59H04 pGCAP1 NM_004322.3  
GGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAG
HKR385753 RBd64G09 pGCAP10 NM_004322.3  
GAGGGGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl