Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V1E1

Gene ID (NCBI) 529
Gene Symbol ATP6V1E1
Protein Name ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Synonyms ATP6E|ATP6E2|ATP6V1E|P31|Vma4
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02150)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083911 IRAL009M23 pOTB7 BC004443 NM_001696 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070532 ARe76F12 pKA1U5 NM_001696.3  
GAGGAACCGGAACCCGCGGTTATAAAGTAAAGGCACNCGAGATCTGCGCAGGGGTTCCCT
HKR205417 ARiS013J01 pGCAP10 NM_001696.3  
GGGTTATAAAGTAAAGGAACCCGAGATCTGCGCAGGGGTTCCCTTTGCCGATTTCTCTCA
HKR218292 ARiS045M04 pGCAP10 NM_001696.3  
GAAAGGAACCCGAGATCTGCGCAGGGGTTCCCTTTGCCGATTTCTCTCACCTCACCTTTC
HKR247395 ARiS118I03 pGCAP10 NM_001696.3  
GANGAACCTNAACCCGCNNNNNTAAAGTAAAGGAACCCGAGATCTGCNCAGGGGTTCCCT
HKR373704 RBd34E08 pGCAP10 NM_001696.3  
GGAACCCGAGATCTGCGCAGGGGTTCCCTTTGCCGATTTCTCTCACCTCACCTTTCAAAC
HKR382807 RBd57A07 pGCAP10 NM_001696.3  
GGTANTGTNNAGNNNCGCGAGANCTGCGCAGGGGTTCCCTTTGNNNNTTTCTCTCACCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl