Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V0C

Gene ID (NCBI) 527
Gene Symbol ATP6V0C
Protein Name ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Synonyms ATP6C|ATP6L|ATPL|VATL|VPPC|Vma3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084985 IRAL012H17 pOTB7 BC004537 NM_001694 Full
HGY086978 IRAL017H10 pOTB7 BC007759 NM_001694 Full
HGY089914 IRAL024N02 pOTB7 BC007389 NM_001694 Full
HGY090453 IRAL026C05 pOTB7 BC009290 NM_001694 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098028 M01C045B04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098076 M01C045D04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098124 M01C045F04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098172 M01C045H04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098220 M01C045J04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098268 M01C045L04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098316 M01C045N04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098364 M01C045P04 pDONR221 MGC12-D02 BC004537 NM_001694  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071656 ARe79C08 pKA1U5 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG
HKR073681 ARe84D09 pKA1U5 NM_001694.2  
ATCCTGATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCA
HKR370580 RBd26H12 pGCAP10 NM_001694.2  
GATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCAAACCT
HKR381380 RBd53H12 pGCAP10 NM_001694.2  
GGCGGTGCTGGNNATANAGAGCGNANCGGCTGANGGGNCGNANNANNNNNCGCCGCCGCC
HKR348406 RBb71A06 pGCAP1 NM_001694.2  
GGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCAAACCTTCGTGCCCG
HKR397257 RBd93C09 pGCAP10 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG
HKR453040 RBdS132J24 pGCAP10 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl