Prev. |  KEGG KO K02155 > 

RIKEN DNA Bank Human Resource - ATP6V0C

Gene ID NCBI Gene 527 |  KEGG hsa:527
Gene Symbol ATP6V0C
Protein Name ATPase H+ transporting V0 subunit c
Synonyms ATP6C|ATP6L|ATPL|VATL|VPPC|Vma3
Featured content Lysosome (human)
Ortholog resource in our bank

  ATP6V0C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084985 IRAL012H17 pOTB7 BC004537 NM_001694 Full
HGY086978 IRAL017H10 pOTB7 BC007759 NM_001694 Full
HGY089914 IRAL024N02 pOTB7 BC007389 NM_001694 Full
HGY090453 IRAL026C05 pOTB7 BC009290 NM_001694 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098028 M01C045B04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098076 M01C045D04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098124 M01C045F04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098172 M01C045H04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098220 M01C045J04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098268 M01C045L04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098316 M01C045N04 pDONR221 MGC12-D02 BC004537 NM_001694  
HGE098364 M01C045P04 pDONR221 MGC12-D02 BC004537 NM_001694  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071656 ARe79C08 pKA1U5 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG
HKR073681 ARe84D09 pKA1U5 NM_001694.2  
ATCCTGATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCA
HKR348406 RBb71A06 pGCAP1 NM_001694.2  
GGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCAAACCTTCGTGCCCG
HKR370580 RBd26H12 pGCAP10 NM_001694.2  
GATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCGCCCGCAAACCT
HKR381380 RBd53H12 pGCAP10 NM_001694.2  
GGCGGTGCTGGNNATANAGAGCGNANCGGCTGANGGGNCGNANNANNNNNCGCCGCCGCC
HKR397257 RBd93C09 pGCAP10 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG
HKR453040 RBdS132J24 pGCAP10 NM_001694.2  
GGCGGTGCTGGTATTTAGAGCGCAGCGGCTGACGGGCCGGATCGCCTTCGCCGCCGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl