Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5J

Gene ID (NCBI) 522
Gene Symbol ATP5J
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Synonyms ATP5|ATP5A|ATPM|CF6|F6
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02131)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY066855 IRAK167C07 pBluescriptR BC066310 NM_001685 Full/var
HGY082564 IRAL006G20 pOTB7 BC001178 NM_001685 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161602 ARi04A02 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR171612 ARi29A12 pGCAP10 NM_001685.4  
GGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGATTCTTCA
HKR179374 ARi48H06 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR185331 ARi63F11 pGCAP10 NM_001685.4  
GGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGATTCTTCAGAGGCTCTTCAGG
HKR068884 ARe72D12 pKA1U5 NM_001685.4  
ATCCTGTGGGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAG
HKR078851 ARe97C03 pKA1U5 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR235063 ARiS087K23 pGCAP10 NM_001685.4  
HKR260299 ARiS150M11 pGCAP10 NM_001685.4  
GGAGGGCCCGCGCTCCCCTCCTCCCCGGCGGCCGCACTCACCCACTCCGGAATCGGCCCT
HKR328131 RBb20F11 pKA1U5 NM_001685.4  
GGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGATTCTTCA
HKR339330 RBb48F10 pGCAP1 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR376945 RBd42G01 pGCAP10 NM_001685.4  
GAAGTAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAAT
HKR378524 RBd46F04 pGCAP10 NM_001685.4  
GGGCTTTGCCAGCTCGGGACTGAGTGCAAGAATCAGCNTGATTCTTCAGAGGCTCTTCAG
HKR340572 RBb51H04 pGCAP1 NM_001685.4  
GGCGGGGGGGCCCTTGTGGGGGAAAAGGCCCCGGAACGAGGCCGGCCCGCGAGGGCCCGC
HKR380977 RBd52H09 pGCAP10 NM_001685.4  
TGGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGA
HKR388121 RBd70F01 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR390129 RBd75F09 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR392852 RBd82C04 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR398855 RBd97C07 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR402996 RBdS007I04 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGGAATATG
HKR433209 RBdS083A09 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC
HKR441617 RBdS104A17 pGCAP10 NM_001685.4  
GAGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl