Prev. |  KEGG KO K02128 > 

RIKEN DNA Bank Human Resource - ATP5G3

Gene ID NCBI Gene 518 |  KEGG hsa:518
Gene Symbol ATP5G3
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9)
Synonyms P3
Ortholog resources KEGG ortholog (KEGG orthology K02128) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048146 ARe20G02 pKA1U5 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR166929 ARi17F09 pGCAP10 NM_001689.4  
GGCCTCCTGGGAAGAGAGGAAGCGGGAGAGGAGCCCACGTCGCCTGTCACCCAATATCTC
HKR179676 ARi49D04 pGCAP10 NM_001689.4  
TCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGGAAGCGGGA
HKR187302 ARi68E06 pGCAP10 NM_001689.4  
GGGGAGAGGAGCCCACGTCCCCTGTCACCCAATATCTCCAGCCGCACAGTCCCGAATAGT
HKR209405 ARiS023I13 pGCAP10 NM_001689.4  
TGATTGAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAA
HKR209569 ARiS023P09 pGCAP10 NM_001689.4  
GAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAG
HKR338175 RBb45H07 pGCAP1 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR340877 RBb52D05 pGCAP1 NM_001689.4  
TGGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTTGCCGCCGCCGCCTCCTGGGAAGAGA
HKR340969 RBb52H01 pGCAP1 NM_001689.4  
GGGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAG
HKR343300 RBb58E04 pGCAP1 NM_001689.4  
GCCCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR343325 RBb58F05 pGCAP1 NM_001689.4  
GCCCCCNCTTCCTTCGACCATCTGTCTTGCAGCCCGATGCCGCCGCCNNCTCCTGGGAAG
HKR365228 RBd13B04 pGCAP10 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR379780 RBd49H12 pGCAP10 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR386851 RBd67C03 pGCAP10 NM_001689.4  
GCTGNNANNAGAGGAANCGGGAGAGGANCCCACGTCGCCTGTCGCCCAATATCTCCNGCC
HKR394174 RBd85H06 pGCAP10 NM_001689.4  
GGAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGA
HKR395380 RBd88H12 pGCAP10 NM_001689.4  
GCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGGAAG
HKR403083 RBdS007L19 pGCAP10 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR405299 RBdS013E03 pGCAP10 NM_001689.4  
GAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAG
HKR408809 RBdS022A09 pGCAP10 NM_001689.4  
GAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAG
HKR428262 RBdS070K22 pGCAP10 NM_001689.4  
GGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGG
HKR432407 RBdS081A07 pGCAP10 NM_001689.4  
GAGTCCCACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAG
HKR462602 RBdS156I10 pGCAP10 NM_001689.4  
GACTCCTTCGACCTCTGCTGCAGCCCGTGCCGCCGCCGCCTCCTGGGAAGAGAGGAAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl