Prev. |  KEGG KO K02127 > 

RIKEN DNA Bank Human Resource - ATP5PB

Gene ID NCBI Gene 515 |  KEGG hsa:515
Gene Symbol ATP5PB
Protein Name ATP synthase peripheral stalk-membrane subunit b
Synonyms ATP5F1|PIG47
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  ATP5PB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086763 IRAL016P03 pDNR-LIB BC005366 NM_001688 Full
HGY088697 IRAL021M09 pDNR-LIB BC005960 NM_001688 Full/var
HGY093106 IRAL032M18 pDNR-LIB BC016350 NM_001688 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052956 ARe32G12 pKA1U5 NM_001688.4  
GATCGGGGTCACAGGGNACGCTAAGATTGCTACCNGGNCTTTCGTTGACCATGCTGTCCC
HKR079725 ARe99F05 pKA1U5 NM_001688.4  
GGGCCATCTTGGTTCTGCCCTGACAGATTCTCCTATCGGGGTCACAGGGACGCTAAGATT
HKR172825 ARi32B01 pGCAP10 NM_001688.4  
GGGGGTCACAGGGACGCTAAGATTGCTACCTGGACTTTCGTTGACCATGCTGTCCCGGGT
HKR188152 ARi70G08 pGCAP10 NM_001688.4  
GAAAAGTTCGTTATGGACTGATCCCTGAGGAATTCTTCCAGTTTCTTTATCCTAAAACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl