Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5F1

Gene ID (NCBI) 515
Gene Symbol ATP5F1
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Synonyms PIG47
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02127)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086763 IRAL016P03 pDNR-LIB BC005366 NM_001688 Full
HGY088697 IRAL021M09 pDNR-LIB BC005960 NM_001688 Full/var
HGY093106 IRAL032M18 pDNR-LIB BC016350 NM_001688 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052956 ARe32G12 pKA1U5 NM_001688.4  
GATCGGGGTCACAGGGNACGCTAAGATTGCTACCNGGNCTTTCGTTGACCATGCTGTCCC
HKR172825 ARi32B01 pGCAP10 NM_001688.4  
GGGGGTCACAGGGACGCTAAGATTGCTACCTGGACTTTCGTTGACCATGCTGTCCCGGGT
HKR188152 ARi70G08 pGCAP10 NM_001688.4  
GAAAAGTTCGTTATGGACTGATCCCTGAGGAATTCTTCCAGTTTCTTTATCCTAAAACTG
HKR079725 ARe99F05 pKA1U5 NM_001688.4  
GGGCCATCTTGGTTCTGCCCTGACAGATTCTCCTATCGGGGTCACAGGGACGCTAAGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl