Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5D

Gene ID (NCBI) 513
Gene Symbol ATP5D
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02134)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY012958 IRAK032G14 pBluescriptR BC018079 NM_001687 Full
HGX039379 IRAK098H11 pCMV-SPORT6 BC050458 NM_001687 Partial
HGX047719 IRAK119E23 pCMV-SPORT6 BC058927 NM_001687 Partial
HGY080426 IRAL001B02 pOTB7 BC002389 NM_001687 Full
HGY083945 IRAL009O09 pOTB7 BC004426 NM_001687 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097641 M01C044B17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097689 M01C044D17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097737 M01C044F17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097785 M01C044H17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097833 M01C044J17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097881 M01C044L17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097929 M01C044N17 pDONR221 MGC11-G09 BC004426 NM_001687  
HGE097977 M01C044P17 pDONR221 MGC11-G09 BC004426 NM_001687  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048902 ARe22E06 pKA1U5 NM_001687.4  
GCTCCTCGCCCTCCAGGCCGCCCGCGCCGCGCCGGTATTCCGCTGTCCGCCAGCTACCCG
HKR168106 ARi20E10 pGCAP10 NM_001687.4  
GAGGCCGCCCGCGCCGCGCCGGAGTCCGCTGTCCGCCAGCTCCCTGCTTCCTGCCGCCCG
HKR176008 ARi40A08 pGCAP10 NM_001687.4  
GGCCCTCCAGGCCGCCCGCGCCGCGCCGGAGTCCGCTGTCCGCCAGCTACCCGCTTCCTG
HKR069377 ARe73H09 pKA1U5 NM_001687.4  
GCCTGCGCGCTCGTCCTCCTCGCCCTCCAGGCCNCCNTNAAAGCGCCGGAGTCCGCTGAT
HKR073281 ARe83D09 pKA1U5 NM_001687.4  
TGGTCTCCTCCCAGACGTCCCTGCGCGTCGTCCTCCTCGCCCTCCAGGCCGCCCGCGCCG
HKR260126 ARiS150F06 pGCAP10 NM_001687.4  
GCCCAGACGTCCCTGCGCGTCGTCCTCCTCGCCCTCCAGGCCGCCCGCGCCGCGCCGGAG
HKR276473 ARiS191D01 pGCAP10 NM_001687.4  
GCTCGCCCTCCAGGCCGCCCGCGCCGCGCCGGAGTCCGCTGTCCGCCAGCTACCCGCTTC
HKR346083 RBb65D11 pGCAP1 NM_001687.4  
TGGCTGTCCGCCAGCTACCCGCTTCCTGCCGCCCGCCGCTGCCATGCTGCCCGCCGCGCT
HKR387349 RBd68G05 pGCAP10 NM_001687.4  
GGTCCNNNNGCTACCCGCTTCCTGCCGCCCGCCGCTGCCATGCTGCCCGCCGCGCTGCTC
HKR409004 RBdS022I12 pGCAP10 NM_001687.4  
GCCTGCGCGTCGTCCTCCTCGCCCTCCAGGCCGCCCGCGCCGCGCCGGAGTCCGCTGTCC
HKR428108 RBdS070E12 pGCAP10 NM_001687.4  
GGCCCGCGCCGCGCCGGAGTCCGCTGTCCGCCAGCTACCCGCTTCCTGCCGCCCGCCGCT
HKR461858 RBdS154K18 pGCAP10 NM_001687.4  
GCTCCTCCCAGACGTCCCTGCGCGTCGTCCTCCTCGCCCTCCAGGCCGCCCGCGCCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl