Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5C1

Gene ID (NCBI) 509
Gene Symbol ATP5C1
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Synonyms ATP5C|ATP5CL1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02136)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001254 IRAK003C06 pCMV-SPORT6 BC000931 NM_005174 Full
HGY080677 IRAL001L13 pOTB7 BC000470 NM_005174 Full
HGY084165 IRAL010G21 pOTB7 BC013394 NM_005174 Full
HGY093017 IRAL032J01 pDNR-LIB BC016812 NM_005174 Full/var
HGY095002 IRAL037I10 pDNR-LIB BC020824 NM_005174 Full
HGY097075 IRAL042L11 pOTB7 BC026049 NM_005174 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160928 ARi02F08 pGCAP10 NM_005174.2  
GGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGCTG
HKR177328 ARi43F08 pGCAP10 NM_005174.2  
GGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGCTG
HKR180456 ARi51C08 pGCAP10 NM_005174.2  
GGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGCTG
HKR264659 ARiS161K19 pGCAP10 NM_005174.2  
GGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGCTG
HKR327636 RBb19B12 pKA1U5 NM_005174.2  
GCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGC
HKR337625 RBb44B01 pGCAP1 NM_005174.2  
AGCAGGGCTGTGGCTACCATGNTTCTCTCGCGCGGGTGTCGCTGGNCTGTCGGCCTGGAC
HKR337655 RBb44C07 pGCAP1 NM_005174.2  
GGTAGCGCGATGAAACGAGACTGAAGAAGAGAGCAAGGTGGGAGGGGCGCGCTGGGGAGC
HKR380426 RBd51B02 pGCAP10 NM_005174.2  
GGAGGCCTGCCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTG
HKR395656 RBd89C08 pGCAP10 NM_005174.2  
GAGGCCTGCCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGT
HKR402890 RBdS007D18 pGCAP10 NM_005174.2  
GGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGCTG
HKR432648 RBdS081K08 pGCAP10 NM_005174.2  
GGAGGCCTGCCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTG
HKR452877 RBdS132D05 pGCAP10 NM_005174.2  
GCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTCTCGCGCGGGTGTCGCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl