Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5B

Gene ID (NCBI) 506
Gene Symbol ATP5B
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Synonyms ATPMB|ATPSB|HEL-S-271
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02133)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001257 IRAK003C09 pCMV-SPORT6 BC016512 NM_001686 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091613 M01C029A13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091661 M01C029C13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091709 M01C029E13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091757 M01C029G13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091805 M01C029I13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091853 M01C029K13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091901 M01C029M13 pDONR221 MGC04-A07 BC016512 NM_001686  
HGE091949 M01C029O13 pDONR221 MGC04-A07 BC016512 NM_001686  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050460 ARe26C12 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR051348 ARe28G04 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR054404 ARe36A04 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGATTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGG
HKR076812 ARe92A12 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR219730 ARiS049F10 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTNCTNCNNN
HKR222295 ARiS055M07 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGNNGCTGCTCNNNN
HKR321260 RBb03C12 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR326829 RBb17B05 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR326978 RBb17H10 pKA1U5 NM_001686.3  
GAGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTG
HKR364170 RBd10H02 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR364802 RBd12A02 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR364926 RBd12F06 pGCAP10 NM_001686.3  
GGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGC
HKR367255 RBd18C07 pGCAP10 NM_001686.3  
ATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATT
HKR328149 RBb20G05 pKA1U5 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR331656 RBb29C08 pGCAP1 NM_001686.3  
GGCTGCAGCCTTCAGTCTCCACCCGGACTACGCCATGNTTGGGGTTTGTGGGTCGGGTGG
HKR333750 RBb34G06 pGCAP1 NM_001686.3  
GAGTCTCCACCCGGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGG
HKR374180 RBd35H12 pGCAP10 NM_001686.3  
GACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGG
HKR337353 RBb43G09 pGCAP1 NM_001686.3  
TTGAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCG
HKR338523 RBb46F03 pGCAP1 NM_001686.3  
TTGAGTCTCCACCCGGACTACGCCATGNTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCC
HKR338580 RBb46H12 pGCAP1 NM_001686.3  
TGAGTCTCCACCCGGACTACGCCATGTTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCG
HKR380832 RBd52B08 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR381650 RBd54C02 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR382474 RBd56D02 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCNNNTNNNCGCTGCTCCGGC
HKR344908 RBb62E12 pGCAP1 NM_001686.3  
HKR346034 RBb65B10 pGCAP1 NM_001686.3  
TTGAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCG
HKR391607 RBd79A07 pGCAP10 NM_001686.3  
GGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGC
HKR392580 RBd81H12 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR394828 RBd87B04 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR396027 RBd90B03 pGCAP10 NM_001686.3  
GCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCT
HKR428319 RBdS070N07 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGNCGCNGCTCCNGC
HKR430318 RBdS075N06 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR433257 RBdS083C09 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR441654 RBdS104C06 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR462473 RBdS156D01 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR471135 RBdS177N23 pGCAP10 NM_001686.3  
GAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGC
HKR471160 RBdS177O24 pGCAP10 NM_001686.3  
TGGAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCG
HKR475116 RBdS187N04 pGCAP10 NM_001686.3  
CGGCCGGCCGATGAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl