Prev. |  KEGG KO K14085 > 

RIKEN DNA Bank Human Resource - ALDH7A1

Gene ID NCBI Gene 501 |  KEGG hsa:501
Gene Symbol ALDH7A1
Protein Name aldehyde dehydrogenase 7 family member A1
Synonyms ATQ1|EPD|PDE
Ortholog resource in our bank

  ALDH7A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066744 IRAK166O08 pCMV-SPORT6 BC071712 NM_001182 Full
HGX069980 IRAK174P20 pCMV-SPORT6 BC073174 NM_001182 Full
HGY081652 IRAL004C04 pOTB7 BC002515 NM_001182 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047273 ARe18D01 pKA1U5 NM_001182.3  
GATCCCGAGTCCCGGGCTCAGTATGTGGCGCCTTCCTCGCGCGCTGTGTGTGCACGCTGC
HKR072057 ARe80C09 pKA1U5 NM_001182.3  
GGTATGTGGCGCCTTCCTCGCGCGCTGTGTGTGCACGCTGCAAAGACCAGCAAGCTCTCT
HKR381275 RBd53D03 pGCAP10 NM_001182.3  
CGGCCGGCCGATGATGTGGCGCCTTCCTCGCGCGCTGTGTGTGCANGCTGCAAAGACCAG
HKR394551 RBd86G07 pGCAP10 NM_001182.3  
GGTGCACGCTGCAAAGACCAGCAAGCTCTCTGGACCTTGGAGCAGGCCTGCCGCCTTCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl