Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP1B3

Gene ID (NCBI) 483
Gene Symbol ATP1B3
Protein Name ATPase, Na+/K+ transporting, beta 3 polypeptide
Synonyms ATPB-3|CD298
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01540)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091357 IRAL028G13 pOTB7 BC011835 NM_001679 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044003 ARe10A03 pKA1U5 NM_001679.2  
GGGCCCAAGCGGCCGCCCGGCGCGGCGCGGCGCAGTCGGCTCGAGTACTCCCCGNTAACG
HKR164906 ARi12E10 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACTG
HKR052971 ARe32H03 pKA1U5 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGNTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACT
HKR188527 ARi71F07 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG
HKR238563 ARiS096G19 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl