DNA Bank Top |  KEGG KO K01540 > 

RIKEN DNA Bank Human Resource - ATP1B3

Gene ID NCBI Gene 483 |  KEGG hsa:483
Gene Symbol ATP1B3
Protein Name ATPase Na+/K+ transporting subunit beta 3
Synonyms ATPB-3|CD298

Link

Ortholog resource in our bank

  ATP1B3

External database

human ATP1B3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07622 pcDNA3.1(+)-hATP1B3    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091357 IRAL028G13 pOTB7 BC011835 NM_001679 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044003 ARe10A03 pKA1U5 NM_001679.2  
GGGCCCAAGCGGCCGCCCGGCGCGGCGCGGCGCAGTCGGCTCGAGTACTCCCCGNTAACG
HKR052971 ARe32H03 pKA1U5 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGNTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACT
HKR164906 ARi12E10 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACTG
HKR188527 ARi71F07 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG
HKR238563 ARiS096G19 pGCAP10 NM_001679.2  
GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl