RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ATP1B3

Gene ID	NCBI Gene 483 \| KEGG hsa:483
Gene Symbol	ATP1B3
Protein Name	ATPase Na+/K+ transporting subunit beta 3
Synonyms	ATPB-3\|CD298

Link

Ortholog resource in our bank

ATP1B3

External database

human ATP1B3

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB07622	pcDNA3.1(+)-hATP1B3

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY091357	IRAL028G13	pOTB7	BC011835	NM_001679	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR044003	ARe10A03	pKA1U5	NM_001679.2
HKR044003	GGGCCCAAGCGGCCGCCCGGCGCGGCGCGGCGCAGTCGGCTCGAGTACTCCCCGNTAACG
HKR052971	ARe32H03	pKA1U5	NM_001679.2
HKR052971	GAGTCGGCTCGAGTACTCCCCGNTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACT
HKR164906	ARi12E10	pGCAP10	NM_001679.2
HKR164906	GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCCGTCCCACCCTTCACTG
HKR188527	ARi71F07	pGCAP10	NM_001679.2
HKR188527	GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG
HKR238563	ARiS096G19	pGCAP10	NM_001679.2
HKR238563	GAGTCGGCTCGAGTACTCCCCGTAACGAGGAGGTGTTCTCGGCGGTCCCACCCTTCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
RIKEN BRC 20th

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl