RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ATP1B2

Gene ID	NCBI Gene 482 \| KEGG hsa:482
Gene Symbol	ATP1B2
Protein Name	ATPase Na+/K+ transporting subunit beta 2
Synonyms	AMOG

Ortholog resource in our bank

  ATP1B2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR442054	RBdS105C06	pGCAP10	NM_001678.3	Full
HKR442054	GCCCCGCACTGCTGAGGAGCGGAGCCTCCGCCTGGGGGGCCCCCCATCCCTGGCTGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl