Prev. |  KEGG KO K01540 > 

RIKEN DNA Bank Human Resource - ATP1B2

Gene ID NCBI Gene 482 |  KEGG hsa:482
Gene Symbol ATP1B2
Protein Name ATPase Na+/K+ transporting subunit beta 2
Synonyms AMOG
Ortholog resources KEGG ortholog (KEGG orthology K01540) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR442054 RBdS105C06 pGCAP10 NM_001678.3  
GCCCCGCACTGCTGAGGAGCGGAGCCTCCGCCTGGGGGGCCCCCCATCCCTGGCTGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl