Prev. |  KEGG KO K01540 > 

RIKEN DNA Bank Human Resource - ATP1B1

Gene ID NCBI Gene 481 |  KEGG hsa:481
Gene Symbol ATP1B1
Protein Name ATPase Na+/K+ transporting subunit beta 1
Synonyms ATP1B
Ortholog resource in our bank

  ATP1B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07620 pcDNA3.1(+)cs-hATP1B1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083138 IRAL007O02 pOTB7 BC000006 NM_001677 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097247 M01C043B23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097295 M01C043D23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097343 M01C043F23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097391 M01C043H23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097439 M01C043J23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097487 M01C043L23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097535 M01C043N23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097583 M01C043P23 pDONR221 MGC11-C12 BC000006 NM_001677  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172106 ARi30E10 pGCAP10 NM_001677.3  
GGCGCGTCTCGCACTCCGAGAGCCGCAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCA
HKR279436 ARiS198J20 pGCAP10 NM_001677.3  
GGCACTCCGAGAGCCGCAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCAGGCCGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl