Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP1B1

Gene ID (NCBI) 481
Gene Symbol ATP1B1
Protein Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms ATP1B
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01540)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083138 IRAL007O02 pOTB7 BC000006 NM_001677 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097247 M01C043B23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097295 M01C043D23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097343 M01C043F23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097391 M01C043H23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097439 M01C043J23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097487 M01C043L23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097535 M01C043N23 pDONR221 MGC11-C12 BC000006 NM_001677  
HGE097583 M01C043P23 pDONR221 MGC11-C12 BC000006 NM_001677  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172106 ARi30E10 pGCAP10 NM_001677.3  
GGCGCGTCTCGCACTCCGAGAGCCGCAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCA
HKR279436 ARiS198J20 pGCAP10 NM_001677.3  
GGCACTCCGAGAGCCGCAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCAGGCCGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl