Prev. |  KEGG KO K01539 > 

RIKEN DNA Bank Human Resource - ATP1A3

Gene ID NCBI Gene 478 |  KEGG hsa:478
Gene Symbol ATP1A3
Protein Name ATPase Na+/K+ transporting subunit alpha 3
Synonyms AHC2|ATP1A1|CAPOS|DEE99|DYT12|RDP
Ortholog resource in our bank

  ATP1A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07618 pcDNA3.1(+)cs-hATP1A3

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086818 IRAL017A18 pOTB7 BC015566 NM_152296 Full
HGY088143 IRAL020F23 pOTB7 BC009282 NM_152296 Full
HGY090671 IRAL026L07 pOTB7 BC009394 NM_152296 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081237 M01C003B13 pDONR221 04-134-2_2-C07 BC015566 NM_152296 done
HGE081285 M01C003D13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081333 M01C003F13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081381 M01C003H13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081429 M01C003J13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081477 M01C003L13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081525 M01C003N13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE081573 M01C003P13 pDONR221 04-134-2_2-C07 BC015566 NM_152296  
HGE098815 M01C047A15 pDONR221 MGC13-A08 BC015566 NM_152296  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277677 ARiS194D05 pGCAP10 NM_152296.3  
GCTCGCCGCGGAGCCGCCAAGATGGGGTCTGGTGGCTCTGACAGCTATCGTATCGCCACC
HKR377347 RBd43G03 pGCAP10 NM_152296.3  
GAGCCTCTGTGCGGTGGGACCAACGGACGGACGGACGGACGCGCGCACCTACCGAGGCGC
HKR378005 RBd45A05 pGCAP10 NM_152296.3  
GAGCCTCTGTGCGGTGGGACCAACGGACGGACGGACGGACGCGCGCACCTACCGAGGCGC
HKR405724 RBdS014F04 pGCAP10 NM_152296.3  
GAGCCTCTGTGCGGTGGGACCAACGGACGGACGGACGGACGCGCGCACCTACCGAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl