Prev. |  KEGG KO K07213 > 

RIKEN DNA Bank Human Resource - ATOX1

Gene ID NCBI Gene 475 |  KEGG hsa:475
Gene Symbol ATOX1
Protein Name antioxidant 1 copper chaperone
Synonyms ATX1|HAH1
Ortholog resources KEGG ortholog (KEGG orthology K07213) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163203 ARi08A03 pGCAP10 NM_004045.3  
GGCCCTCCGAATCCAGAGAGGCGCTGCTGACACCGCCGCCACACCGCCGCCACACCGCCG
HKR170458 ARi26C10 pGCAP10 NM_004045.3  
GGCCCTCCGAATCCAGAGAGGCGCTGCTGACACCGCCGCCACACCGCCGCCACACCGCCG
HKR182429 ARi56B05 pGCAP10 NM_004045.3  
GAGAGAGGCGCTGCTGACACCGCCGCCACACCGCCGCCACACCGCCGCTGCCTCAGTCAT
HKR182922 ARi57F02 pGCAP10 NM_004045.3  
GGCCCTCCGAATCCAGAGAGGCGCTGCTGACACCGCCGCCACACCGCCGCCACACCGCCG
HKR186876 ARi67D04 pGCAP10 NM_004045.3  
AGAGAGGCGCTGCTGACACCGCCGCCACACCGCCGCCACACCGCCGCTGCCTCAGTCATG
HKR203555 ARiS008O19 pGCAP10 NM_004045.3  
GACACCGCCGCCACNCCGCCGCTGCCTCAGTCATGCCGAANCACGAGTTCTCTGTGGACA
HKR340123 RBb50F03 pGCAP1 NM_004045.3  
GATCCAGAGAGGCGCTGCTGACACCGCCGCCACACCGGCCGCCACTNCGCCGCTGCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl