Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASPH

Gene ID (NCBI) 444
Gene Symbol ASPH
Protein Name aspartate beta-hydroxylase
Synonyms AAH|BAH|CASQ2BP1|HAAH|JCTN|junctin
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00476)


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043700 ARe09E04 pKA1U5 NM_004318.3  
GGGGAGTCACAGGTTCGTACACGCGAGGCCGGGCGCGCGCAGCCGGCAGGCGGGTGAAGT
HKR170921 ARi27F01 pGCAP10 NM_004318.3  
GAGTCTTCCCAGGTGCTGCAGGCGGTGCTGAGGCACAGGGTCTGCTGCAGGAGCAGCGGC
HKR077353 ARe93G09 pKA1U5 NM_004318.3  
CCAGGTTCGTACACGCGAGGCCGGGCGCGCGCAGCCGGCAGGCGGGTGAAGTCTTCCCAG
HKR203379 ARiS008H11 pGCAP10 NM_004318.3  
GAGGCGGTGCTGAGGCACAGGGTCTGCTGCAGGAGCAGCGGCCCGAACCCGCTCCAGCGG
HKR234050 ARiS085C02 pGCAP10 NM_004318.3  
GGCTCTCGCCCCGGGAGGGAGTCACAGGTTCGTACACGCGAGGCCGGGCGCGCGCAGCCG
HKR235446 ARiS088K06 pGCAP10 NM_004318.3  
GAGGCGGGTGAAGTCTTCCCAGGTGCTGCAGGCGGTGCTGAGGCACAGGGTCTGCTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl