Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASNS

Gene ID (NCBI) 440
Gene Symbol ASNS
Protein Name asparagine synthetase (glutamine-hydrolyzing)
Synonyms ASNSD|TS11
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07305 pGL4-phASNS Promoter collection, Human ASNS promoter

RDB_hum_170217.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080718 IRAL001N06 pOTB7 BC008723 NM_183356 Full
HGY084214 IRAL010I22 pOTB7 BC014621 NM_183356 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361276 RBd03D04 pGCAP10 NM_001673.3  
GGCACGCGTTACAGGAGCCAGGTCGGTATAAGCGCCAGCGGCCTCGCCGCCCGTCAAGCT
HKR325770 RBb14H02 pKA1U5 NM_001673.3  
GAGCGGCCTCACCNCCCGTCAAGCTGTTCCACATCCCTTTNACCTCAGTCCCGCCACAAT
HKR376148 RBd40G04 pGCAP10 NM_001673.3  
ATACATCACCCTGACCTGCTTACGCCCAGATTTTCTTCAATCACATCTGAATAAATCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.03.14

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl