RIKEN DNA Bank Human Resource

DNA Bank Top | KEGG KO K01953 >

RIKEN DNA Bank Human Resource - ASNS

Gene ID	NCBI Gene 440 \| KEGG hsa:440
Gene Symbol	ASNS
Protein Name	asparagine synthetase (glutamine-hydrolyzing)
Synonyms	ASNSD\|TS11

Link

Ortholog resource in our bank

ASNS

External database

human ASNS

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB07305	pGL4-phASNS	Promoter collection, Human ASNS promoter

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY080718	IRAL001N06	pOTB7	BC008723	NM_183356	Full
HGY084214	IRAL010I22	pOTB7	BC014621	NM_183356	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR325770	RBb14H02	pKA1U5	NM_001673.3
HKR325770	GAGCGGCCTCACCNCCCGTCAAGCTGTTCCACATCCCTTTNACCTCAGTCCCGCCACAAT
HKR361276	RBd03D04	pGCAP10	NM_001673.3
HKR361276	GGCACGCGTTACAGGAGCCAGGTCGGTATAAGCGCCAGCGGCCTCGCCGCCCGTCAAGCT
HKR376148	RBd40G04	pGCAP10	NM_001673.3
HKR376148	ATACATCACCCTGACCTGCTTACGCCCAGATTTTCTTCAATCACATCTGAATAAATCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl