Prev. |  KEGG KO K01953 > 

RIKEN DNA Bank Human Resource - ASNS

Gene ID NCBI Gene 440 |  KEGG hsa:440
Gene Symbol ASNS
Protein Name asparagine synthetase (glutamine-hydrolyzing)
Synonyms ASNSD|TS11
Ortholog resource in our bank

  ASNS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07305 pGL4-phASNS Promoter collection, Human ASNS promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080718 IRAL001N06 pOTB7 BC008723 NM_183356 Full
HGY084214 IRAL010I22 pOTB7 BC014621 NM_183356 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325770 RBb14H02 pKA1U5 NM_001673.3  
GAGCGGCCTCACCNCCCGTCAAGCTGTTCCACATCCCTTTNACCTCAGTCCCGCCACAAT
HKR361276 RBd03D04 pGCAP10 NM_001673.3  
GGCACGCGTTACAGGAGCCAGGTCGGTATAAGCGCCAGCGGCCTCGCCGCCCGTCAAGCT
HKR376148 RBd40G04 pGCAP10 NM_001673.3  
ATACATCACCCTGACCTGCTTACGCCCAGATTTTCTTCAATCACATCTGAATAAATCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl