Prev. |  KEGG KO K01551 > 

RIKEN DNA Bank Human Resource - GET3

Gene ID NCBI Gene 439 |  KEGG hsa:439
Gene Symbol GET3
Protein Name guided entry of tail-anchored proteins factor 3, ATPase
Synonyms ARSA-I|ARSA1|ASNA-I|ASNA1|TRC40
Ortholog resource in our bank

  GET3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084913 IRAL012E17 pOTB7 BC002651 NM_004317 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018466 W01A046C18 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018468 W01A046C20 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018472 W01A046C24 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018498 W01A046E02 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018500 W01A046E04 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018502 W01A046E06 pENTR-TOPO IRAL012E17 BC002651 NM_004317  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348926 RBb72F06 pGCAP1 NM_004317.2  
AGTTCCAAAATGGCGGCAGGGGTGGCCGGGTGGGGGGTTGAGGCAGAGGAGTTCGAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl