Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASNA1

Gene ID (NCBI) 439
Gene Symbol ASNA1
Protein Name arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Synonyms ARSA-I|ARSA1|ASNA-I|GET3|TRC40|hASNA-I
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01551)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084913 IRAL012E17 pOTB7 BC002651 NM_004317 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018466 W01A046C18 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018468 W01A046C20 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018472 W01A046C24 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018498 W01A046E02 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018500 W01A046E04 pENTR-TOPO IRAL012E17 BC002651 NM_004317  
HGE018502 W01A046E06 pENTR-TOPO IRAL012E17 BC002651 NM_004317  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348926 RBb72F06 pGCAP1 NM_004317.2  
AGTTCCAAAATGGCGGCAGGGGTGGCCGGGTGGGGGGTTGAGGCAGAGGAGTTCGAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl