Prev. |  KEGG KO K12348 > 

RIKEN DNA Bank Human Resource - ASAH1

Gene ID NCBI Gene 427 |  KEGG hsa:427
Gene Symbol ASAH1
Protein Name N-acylsphingosine amidohydrolase 1
Synonyms AC|ACDase|ASAH|PHP|PHP32|SMAPME
Featured content Sphingolipid signaling pathway (human)
Featured content Lysosome (human)
Ortholog resource in our bank

  ASAH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010482 IRAK026D10 pCMV-SPORT6 BC016481 NM_177924 Full
HGY092825 IRAL032B01 pDNR-LIB BC016828 NM_004315 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347677 RBb69D05 pGCAP1 NM_177924.3  
GGCTTCTTTGCCTCTGCTGGAGTCCGGGGAGTGGCGTTGGCTGCTAGAGCGATGCCGGGC
HKR405544 RBdS013O08 pGCAP10 NM_177924.3  
GGGCCTCTGCTGGAGTCCGGGGAGTGGCGTTGGCTGCTAGAGCGATGCCGGGCCGGAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl