Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASAH1

Gene ID (NCBI) 427
Gene Symbol ASAH1
Protein Name N-acylsphingosine amidohydrolase (acid ceramidase) 1
Synonyms AC|ACDase|ASAH|PHP|PHP32|SMAPME
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Sphingolipid signaling pathway (human)
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010482 IRAK026D10 pCMV-SPORT6 BC016481 NM_177924 Full
HGY092825 IRAL032B01 pDNR-LIB BC016828 NM_004315 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR347677 RBb69D05 pGCAP1 NM_177924.3  
GGCTTCTTTGCCTCTGCTGGAGTCCGGGGAGTGGCGTTGGCTGCTAGAGCGATGCCGGGC
HKR405544 RBdS013O08 pGCAP10 NM_177924.3  
GGGCCTCTGCTGGAGTCCGGGGAGTGGCGTTGGCTGCTAGAGCGATGCCGGGCCGGAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl