Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARRB2

Gene ID (NCBI) 409
Gene Symbol ARRB2
Protein Name arrestin, beta 2
Synonyms ARB2|ARR2|BARR2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020227 IRAK050J11 pCMV-SPORT6 BC039066 NM_004313 Partial
HGX055886 IRAK139L22 pCMV-SPORT6 BC067368 NM_004313 Full
HGY084074 IRAL010D02 pOTB7 BC007427 NM_004313 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326412 RBb16A12 pKA1U5 NM_004313.3  
GAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTAC
HKR383675 RBd59D03 pGCAP10 NM_004313.3  
GGAGCGAGCCGCGAACCGAGCGGGCGGCGGGCGCGCGCACCATGGGGGAGAAACCCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl