Prev. |  KEGG KO K04439 > 

RIKEN DNA Bank Human Resource - ARRB2

Gene ID NCBI Gene 409 |  KEGG hsa:409
Gene Symbol ARRB2
Protein Name arrestin beta 2
Synonyms ARB2|ARR2|BARR2
Featured content Endocytosis (human)
Ortholog resource in our bank

  ARRB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055886 IRAK139L22 pCMV-SPORT6 BC067368 NM_004313 Full
HGX020227 IRAK050J11 pCMV-SPORT6 BC039066 NM_004313 Partial
HGY084074 IRAL010D02 pOTB7 BC007427 NM_004313 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326412 RBb16A12 pKA1U5 NM_004313.3  
GAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTAC
HKR383675 RBd59D03 pGCAP10 NM_004313.3  
GGAGCGAGCCGCGAACCGAGCGGGCGGCGGGCGCGCGCACCATGGGGGAGAAACCCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl