Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARNTL

Gene ID (NCBI) 406
Gene Symbol ARNTL
Protein Name aryl hydrocarbon receptor nuclear translocator-like
Synonyms BMAL1|BMAL1c|JAP3|MOP3|PASD3|TIC|bHLHe5
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Circadian clock (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02296)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14174 pGL3_hBmalPro-Luc (-3465_Full) Reporter plasmid of human Baml 1 promoter.
RDB14175 pGL3_hBmalPro-Luc (-2442_+57) Reporter plasmid of human Baml 1 promoter.
RDB14176 pGL3_hBmalPro-Luc (-1579_+57) Reporter plasmid of human Baml 1 promoter.
RDB14177 pGL3_hBmalPro-Luc (-829_+57) Reporter plasmid of human Baml 1 promoter.
RDB14178 pGL3_hBmalPro-Luc (-481_+57) Reporter plasmid of human Baml 1 promoter.
RDB14179 pGL3_hBmalPro-Luc (-230_+57) Reporter plasmid of human Baml 1 promoter.
RDB14180 pGL3_hBmalPro-Luc (-829_+57 RORE1 mut/RORE2 Reporter plasmid of E-box (E1 mutant) of human Baml 1 promoter.
RDB14181 pGL3_hBmalPro-Luc (-829_+57 RORE1 /RORE2 mut) Reporter plasmid of E-box (E2 mutant) of human Baml 1 promoter.
RDB14182 pGL3_hBmalPro-Luc(-829_+57 RORE1 mut/RORE2 mut) Reporter plasmid of E-box (E1 and E2 mutants) of human Baml 1 promoter.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033044 IRAK082K04 pCMV-SPORT6 BC041129 NM_001178 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028013 W01A070A13 pENTR-TOPO flj0024d21 AK095749 NM_001030273 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056027 ARe40B03 pKA1U5 NM_001178.4  
GGGTGCGACATTTAGGGAAGGCAGAAAGTAGGTCAGGGTACGGAGGTGCCTGTTTACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl