DNA Bank Top |  KEGG KO K02296 > 

RIKEN DNA Bank Human Resource - BMAL1

Gene ID NCBI Gene 406 |  KEGG hsa:406
Gene Symbol BMAL1
Protein Name basic helix-loop-helix ARNT like 1
Synonyms ARNTL|ARNTL1|BMAL1c|JAP3|MOP3|PASD3|TIC|bHLHe5
Featured content Circadian clock (human)

Link

Ortholog resource in our bank

  BMAL1


External database

human BMAL1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15085 human Bmal1 (-1.7 - +0.1 kb)_luciferase/pENTR-1A Gateway(R) entry vector with human Arntl/Bmal1 [-1.7 to +0.1 kb]-luciferase fragment.    
RDB14182 pGL3_hBmalPro-Luc(-829_+57 RORE1 mut/RORE2 mut) Reporter plasmid of E-box (E1 and E2 mutants) of human Baml 1 promoter.    
RDB14181 pGL3_hBmalPro-Luc (-829_+57 RORE1 /RORE2 mut) Reporter plasmid of E-box (E2 mutant) of human Baml 1 promoter.    
RDB14180 pGL3_hBmalPro-Luc (-829_+57 RORE1 mut/RORE2 Reporter plasmid of E-box (E1 mutant) of human Baml 1 promoter.    
RDB14179 pGL3_hBmalPro-Luc (-230_+57) Reporter plasmid of human Baml 1 promoter.    
RDB14178 pGL3_hBmalPro-Luc (-481_+57) Reporter plasmid of human Baml 1 promoter.    
RDB14177 pGL3_hBmalPro-Luc (-829_+57) Reporter plasmid of human Baml 1 promoter.    
RDB14176 pGL3_hBmalPro-Luc (-1579_+57) Reporter plasmid of human Baml 1 promoter.    
RDB14175 pGL3_hBmalPro-Luc (-2442_+57) Reporter plasmid of human Baml 1 promoter.    
RDB14174 pGL3_hBmalPro-Luc (-3465_Full) Reporter plasmid of human Baml 1 promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033044 IRAK082K04 pCMV-SPORT6 BC041129 NM_001178 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028013 W01A070A13 pENTR-TOPO flj0024d21 AK095749 NM_001030273 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056027 ARe40B03 pKA1U5 NM_001178.4  
GGGTGCGACATTTAGGGAAGGCAGAAAGTAGGTCAGGGTACGGAGGTGCCTGTTTACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl