Prev. |  KEGG KO K09097 > 

RIKEN DNA Bank Human Resource - ARNT

Gene ID NCBI Gene 405 |  KEGG hsa:405
Gene Symbol ARNT
Protein Name aryl hydrocarbon receptor nuclear translocator
Synonyms HIF-1-beta|HIF-1beta|HIF1-beta|HIF1B|HIF1BETA|TANGO|bHLHe2
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  ARNT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07731 pGL4-phARNT Promoter collection, Human ARNT promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032961 IRAK082G17 pCMV-SPORT6 BC041121 NM_178427 Full/var
HGY053573 IRAK133P13 pBluescript BC060838 NM_178427 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056033 ARe40B09 pKA1U5 NM_001668.2  
GCCCACTGGGGGGGGGTGGCGCGGCGGCGGTGGCATCTGCGGCCATGGCGGCGACTACTG
HKR068980 ARe72H12 pKA1U5 NM_001668.2  
GGCCATCTTGGATTCCGCGGTAGCGGAGGCGGCCNTNAGGCGCCGCTTCTGGGGAGTGGC
HKR074804 ARe87A04 pKA1U5 NM_001668.2 done
GGGTGGCATCTGCGGCCATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl