RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ARNT

Gene ID	NCBI Gene 405 \| KEGG hsa:405
Gene Symbol	ARNT
Protein Name	aryl hydrocarbon receptor nuclear translocator
Synonyms	HIF-1-beta\|HIF-1beta\|HIF1-beta\|HIF1B\|HIF1BETA\|TANGO\|bHLHe2
Featured content	HIF-1 signaling pathway - human

Ortholog resource in our bank

  ARNT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB07731	pGL4-phARNT	Promoter collection, Human ARNT promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX032961	IRAK082G17	pCMV-SPORT6	BC041121	NM_178427	Full/var
HGY053573	IRAK133P13	pBluescript	BC060838	NM_178427	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR056033	ARe40B09	pKA1U5	NM_001668.2
HKR056033	GCCCACTGGGGGGGGGTGGCGCGGCGGCGGTGGCATCTGCGGCCATGGCGGCGACTACTG
HKR068980	ARe72H12	pKA1U5	NM_001668.2
HKR068980	GGCCATCTTGGATTCCGCGGTAGCGGAGGCGGCCNTNAGGCGCCGCTTCTGGGGAGTGGC
HKR074804	ARe87A04	pKA1U5	NM_001668.2
HKR074804	GGGTGGCATCTGCGGCCATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl