Prev. |  KEGG KO K07942 > 

RIKEN DNA Bank Human Resource - ARL1

Gene ID NCBI Gene 400 |  KEGG hsa:400
Gene Symbol ARL1
Protein Name ADP ribosylation factor like GTPase 1
Synonyms ARFL1
Ortholog resource in our bank

  ARL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB20101 hARL1(WT)-EGFP Expression vector of human ARL1 for mammalian cells, C-teminal EGFP-tag.
RDB20102 hARL1(Q71L)-EGFP Expression vector of human ARL1 mutant (Q71L) for mammalian cells, C-teminal EGFP-tag.
RDB20103 hARL1(T31N)-EGFP Expression vector of human ARL1 mutant (T31N) for mammalian cells, C-teminal EGFP-tag.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086752 IRAL016O16 pDNR-LIB BC007000 NM_001177 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182552 ARi56G08 pGCAP10 NM_001177.3  
GGCCTGGAGTCCGACGTGGAAGTTGCTGGCTGACTGGGCTTGCGAGGAAACCGCCTCGGA
HKR248875 ARiS122D03 pGCAP10 NM_001177.3  
CCCTCGCTCCCGCCCCCGCCTGGAGTCCGACGTGGAAGTTGCTGGCTGACTGGCCTTGC
HKR248983 ARiS122H15 pGCAP10 NM_001177.3  
CCCTCGCTCCCGCCCCCGCCTGGAGTCCGACGTGGAAGTTGCTGGCTGACTGGCCTTGC
HKR397304 RBd93E08 pGCAP10 NM_001177.3  
GGAAGTTGCTGGCTGACTGGGCTTGCGAGGAAACCGCCTCGGAGCTGCAGCCGAAGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.12.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl