Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARF6

Gene ID (NCBI) 382
Gene Symbol ARF6
Protein Name ADP-ribosylation factor 6
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07941)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15349 pcDNA3/hArf6(WT)-HA Expression vector of human ARF6, wild type.
RDB15350 pcDNA3/hArf6(Q67L)-HA Expression vector of human ARF6, dominant activating mutant Q67L.
RDB15351 pcDNA3/hArf6(T27N)-HA Expression vector of human ARF6, inactivating mutant T27N.
RDB15352 pcDNA3/hArf6(WT)-mCherry Expression vector of human ARF6, wild type.
RDB15353 pEGFP-N3/hArf6(WT)-EGFP Expression vector of human ARF6, wild type.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083462 IRAL008K22 pOTB7 BC002952 NM_001663 Full
HGY089909 IRAL024M21 pOTB7 BC008918 NM_001663 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR369679 RBd24D07 pGCAP10 NM_001663.3  
GGGTTTCCTCGGCGCCTTTTCCGGCAGCGGCGGCGGCAGAACTGGGAGGAGGAGTTGGAG
HKR382978 RBd57H10 pGCAP10 NM_001663.3  
NNNTCGNGNGGGGAGCCCAGCNGCTCGNGGNCGGCGGGNGGNNCNNNNNNNNNNNCAGNC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.27

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl