DNA Bank Top |  KEGG KO K07940 > 

RIKEN DNA Bank Human Resource - ARF5

Gene ID NCBI Gene 381 |  KEGG hsa:381
Gene Symbol ARF5
Protein Name ADP ribosylation factor 5
Synonyms -
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  ARF5


External database

human ARF5

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15361 pcDNA3/hArf5(T31N)-HA Expression vector of mouse ARF5, inactive mutant T31N.    
RDB15360 pcDNA3/hArf5(Q71L)-HA Expression vector of mouse ARF5, constitutively active mutant Q71L.    
RDB15359 pcDNA3/hArf5(WT)-HA Expression vector of human ARF5, wild type.    
RDB15348 pEGFP-N3/hArf5(WT)-EGFP Expression vector of human ARF5, wild type.    
RDB15347 pcDNA3/hArf5(WT)-mCherry Expression vector of human ARF5, wild type.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083602 IRAL009A02 pOTB7 BC003043 NM_001662 Full
HGY097388 IRAL043H20 pOTB7 BC033104 NM_001662 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050427 ARe26B03 pKA1U5 NM_001662.2  
GGCGGAGGCGGCGGCGGAGCCTCCTCCTGCTGCTGCTGCGCCCCATCCCCCCGCGGCCGG
HKR170908 ARi27E12 pGCAP10 NM_001662.2  
TGGCTGCGCCCCATCCCCCCGCGGCCGGCCAGTTCCAGCCCGCACCCCGCGTCGGTGCCC
HKR172081 ARi30D09 pGCAP10 NM_001662.2  
GGCAGCGACGCGCGGAGGCGGCGGCGGAGCCTCCTCCTGCTGCTGCTGCGCCCCATCCCC
HKR209567 ARiS023P07 pGCAP10 NM_001662.2  
GAGCGACGCGCGGAGGCGGCGGCGGAGCCTCCTCCTGCTGCTGCTGCGCCCCATCCCCCC
HKR378172 RBd45H04 pGCAP10 NM_001662.2  
GGGAGCCTCCTCCTGCTGCTGCTGCGCCCCATCCCCCCGCGGCCGGCCAGTTCCAGCCCG
HKR444193 RBdS110I01 pGCAP10 NM_001662.2  
GGCTGCGCCCCATCCCCCCGCGGCCGGCCAGTTCCAGCCCGCACCCCGCGTCGGAGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl