Prev. |  KEGG KO K07945 > 

RIKEN DNA Bank Human Resource - ARL4D

Gene ID NCBI Gene 379 |  KEGG hsa:379
Gene Symbol ARL4D
Protein Name ADP ribosylation factor like GTPase 4D
Synonyms ARF4L|ARL6
Ortholog resource in our bank

  ARL4D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083030 IRAL007J14 pOTB7 BC000043 NM_001661 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036040 W01A090B16 pENTR-TOPO IRAL007J14 BC000043 NM_001661  
HGE036080 W01A090D08 pENTR-TOPO IRAL007J14 BC000043 NM_001661  
HGE036086 W01A090D14 pENTR-TOPO IRAL007J14 BC000043 NM_001661  
HGE036090 W01A090D18 pENTR-TOPO IRAL007J14 BC000043 NM_001661  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR333605 RBb34A05 pGCAP1 NM_001661.3  
GAGAGGCAGCGGTTGGAGGCGCGGTGGGTGTCTGCGGGGGTCTCGCGGGGCGGCTGCGGT
HKR336505 RBb41E09 pGCAP1 NM_001661.3  
GAGAGGCAGCGGTTGGAGGCGCGGTGGGTGTCTGCGGGGGTCTCGCGGGGCGGCTGCGGT
HKR341375 RBb53H07 pGCAP1 NM_001661.3  
GAGAGGCAGCGGTTGGAGGCGCGGTGGGTGTCTGCGGGGGTCTCGCGGGGCGGCTGCGGT
HKR389354 RBd73G10 pGCAP10 NM_001661.3  
GAGAGGCAGCGGTTGGAGGCGCGGTGGGTGTCTGCGGGGGTCTCGCGGGGCGGCTGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl