Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARF4

Gene ID (NCBI) 378
Gene Symbol ARF4
Protein Name ADP-ribosylation factor 4
Synonyms ARF2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07939)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15354 pCAG/hArf4(WT)-HA Expression vector of human ARF4, wild type.
RDB15355 pCAG/hArf4(Q71L)-HA Expression vector of human ARF4, constitutively active mutant Q71L.
RDB15356 pCAG/hArf4(T31N)-HA Expression vector of human ARF4, inactive mutant T31N.
RDB15357 pCAG/hArf4(WT)-mCherry Expression vector of human ARF4, wild type.
RDB15358 pCAG/hArf4(WT)-EGFP Expression vector of human ARF4, wild type.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001547 IRAK003O11 pCMV-SPORT6 BC003364 NM_001660 Full
HGY082300 IRAL005M12 pOTB7 BC008753 NM_001660 Full
HGY092883 IRAL032D11 pDNR-LIB BC022866 NM_001660 Full
HGY093009 IRAL032I17 pDNR-LIB BC016325 NM_001660 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043772 ARe09H04 pKA1U5 NM_001660.3  
GGCACAGCCAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCC
HKR162946 ARi07G02 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR048082 ARe20D10 pKA1U5 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR048924 ARe22F04 pKA1U5 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR049353 ARe23G09 pKA1U5 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR176152 ARi40G08 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR060008 ARe50A08 pKA1U5 NM_001660.3  
GGTGGAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCAC
HKR208338 ARiS020O02 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR209563 ARiS023P03 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR234094 ARiS085D22 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR234842 ARiS087B18 pGCAP10 NM_001660.3  
GAAAGGCTAGAGCCGGANCTGCCGCGCCAGTCGCCTAGCAGGTCCTCTACCGGCTTATTC
HKR247485 ARiS118L21 pGCAP10 NM_001660.3  
GACAGCCAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTC
HKR324077 RBb10D05 pKA1U5 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR366126 RBd15F06 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR372123 RBd30F03 pGCAP10 NM_001660.3  
GGCCGGGCCGCTGCTGGAGTCGCCGCGGCCGCCGCGTGACGTGGCACAGCCAGAGCCTAA
HKR374952 RBd37G08 pGCAP10 NM_001660.3  
GGAGTCGCCGCGGCCGCCGCGTGACGTGGCACAGCCAGAGCCTAAAGGCTAGAGCCGGAG
HKR376829 RBd42B05 pGCAP10 NM_001660.3  
GAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGG
HKR384455 RBd61C07 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR390449 RBd76C01 pGCAP10 NM_001660.3  
GACAGCCAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTC
HKR393704 RBd84E08 pGCAP10 NM_001660.3  
GACAGCCAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTC
HKR405543 RBdS013O07 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR428327 RBdS070N15 pGCAP10 NM_001660.3  
GAGTCGCCTAGCAGGTCCTCTACCGGCTTATTCCTGTGCCGGATCTTCATCGGCACAGGG
HKR433506 RBdS083M18 pGCAP10 NM_001660.3  
GAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTCTACCGG
HKR444024 RBdS110A24 pGCAP10 NM_001660.3  
GAGAGCCTAAAGGCTAGAGCCGGAGCTGCCGCGCCAGTCGCCTAGCAGGTCCTCTACCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.27

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl