Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARF1

Gene ID (NCBI) 375
Gene Symbol ARF1
Protein Name ADP-ribosylation factor 1
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07937)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04122 pAxCALNLhARF1 Shuttle vector to generate rAd harboring human ARF1
RDB04154 pAxCALNLhARF1 Shuttle vector to generate rAd harboring human ARF1
RDB03548 pAxCALNLhARF1 (forward) Shuttle vector to generate rAd harboring human ARF1 (forward)
RDB03587 pAxCALNLhARF1 (forward) Shuttle vector to generate rAd harboring human ARF1 (forward)
RDB04694 pAxCALNLhARF1(forward) Shuttle vector to generate rAd expressing human ARF1
RDB05014 pAxCALNLhARF1(forward) Shuttle vector to generate rAd expressing human ARF1
RDB05015 pAxCALNLhARF1(reverse) Shuttle vector to generate rAd expressing human ARF1
RDB15337 pcDNA3/hArf1(WT)-HA Expression vector of human ARF1, wild type.
RDB15340 pEGFP-N3/hArf1(WT)-EGFP Expression vector of human ARF1, wild type.
RDB15345 pcDNA3/hArf1(WT)-mCherry Expression vector of human ARF1, wild type.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX004824 IRAK012A24 pCMV-SPORT6 BC011358 NM_001658 Full
HGY084137 IRAL010F17 pOTB7 BC009247 NM_001658 Full
HGY089209 IRAL023A09 pOTB7 BC010429 NM_001658 Full
HGY090298 IRAL025M10 pOTB7 BC010415 NM_001658 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060122 ARe50F02 pKA1U5 NM_001658.3  
GGCCGCCGNTCAGAGCCGCCATCTTGTGGGAGCAAAACCAACGCCTGGCTCGGAGCAGCA
HKR064879 ARe62D07 pKA1U5 NM_001658.3  
GGTGGNAGCAAAACCAACGCCTGNCCTCGGAGCAGCAGCCTCTGAGGTGTCCCTGGCCAN
HKR069253 ARe73C05 pKA1U5 NM_001658.3  
GGTGGCCGCCGCTCAGAGCCGCCATCTTGGTGGGACCNTTAAAACGCCTGGCTCGGAGCA
HKR209268 ARiS023C20 pGCAP10 NM_001658.3  
GGAGCAAAACCAACGCCTGGCTCGGAGCAGCAGCCTCTGAGGTGTCCCTGGCCAGTGTCC
HKR218043 ARiS045B19 pGCAP10 NM_001658.3  
GNNGGGANCAANNNCNNNNNCTGGCTCGGAACANCAGCCTCTGAGGTGTCCCTGGCCAGT
HKR367700 RBd19E04 pGCAP10 NM_001658.3  
GGGGAGCAAAACCAACGCCTGGCTCGGAGCAGCAGCCTCTGAGGTGTCCCTGGCCAGTGT
HKR342174 RBb55H06 pGCAP1 NM_001658.3  
GTGGCCGCCGTCAGAGCCGCCATCTTGTGGGAGCAAAACCAACGCCTGGCTCGGAGCAGC
HKR408830 RBdS022B06 pGCAP10 NM_001658.3  
GGGGAGCAAAACCAACGCCTGGCTCGGAGCAGCAGCCTCTGAGGTGTCCCTGGCCAGTGT
HKR452832 RBdS132B08 pGCAP10 NM_001658.3  
GGTGGGAGCAAAACCAACGCCTGGCTCGGAGCAGCAGCCTCTGAGGTGTCCCTGGCCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.27

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl