DNA Bank Top |  KEGG KO K20471 > 

RIKEN DNA Bank Human Resource - ARCN1

Gene ID NCBI Gene 372 |  KEGG hsa:372
Gene Symbol ARCN1
Protein Name archain 1
Synonyms COPD|SRMMD|SSMG

Link

Ortholog resource in our bank

  ARCN1

External database

human ARCN1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04844 SEREX clone NGO-Pr-146 (ID 2488) #1 SEREX clone NGO-Pr-146 (ID 2488) #1    
RDB03882 SEREX clone NGO-St-118 (ID 1329) #1 SEREX clone NGO-St-118 (ID 1329) #1    
RDB03805 SEREX clone NGO-St-006 (ID 13) #2 SEREX clone NGO-St-006 (ID 13) #2    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208012 ARiS020A12 pGCAP10 NM_001655.4  
GGCTTGGGGCCGCCATCTTGGCAAGAGGCGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAG
HKR208056 ARiS020C08 pGCAP10 NM_001655.4  
GATCTTGGCAAGAGGCGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAGCAGGTCCAGAGCT
HKR218027 ARiS045B03 pGCAP10 NM_001655.4  
NGGGGGCCNCCNTCTTGNNTTNNNCNAAGCGGCNNCGGTTCCTGTCAAGGGGGCAGCAGG
HKR264526 ARiS161F06 pGCAP10 NM_001655.4  
GGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAGCAGGTCCAGAGCTGCTGGTGCTCCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl