Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARCN1

Gene ID (NCBI) 372
Gene Symbol ARCN1
Protein Name archain 1
Synonyms COPD
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K20471)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04844 SEREX clone NGO-Pr-146 (ID 2488) #1 SEREX clone NGO-Pr-146 (ID 2488) #1
RDB03805 SEREX clone NGO-St-006 (ID 13) #2 SEREX clone NGO-St-006 (ID 13) #2
RDB03882 SEREX clone NGO-St-118 (ID 1329) #1 SEREX clone NGO-St-118 (ID 1329) #1

RDB_org_170226.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208012 ARiS020A12 pGCAP10 NM_001655.4  
GGCTTGGGGCCGCCATCTTGGCAAGAGGCGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAG
HKR208056 ARiS020C08 pGCAP10 NM_001655.4  
GATCTTGGCAAGAGGCGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAGCAGGTCCAGAGCT
HKR218027 ARiS045B03 pGCAP10 NM_001655.4  
NGGGGGCCNCCNTCTTGNNTTNNNCNAAGCGGCNNCGGTTCCTGTCAAGGGGGCAGCAGG
HKR264526 ARiS161F06 pGCAP10 NM_001655.4  
GGAAGCGGCAGCGGTTCCTGTCAAGGGGGCAGCAGGTCCAGAGCTGCTGGTGCTCCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl