Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARAF

Gene ID (NCBI) 369
Gene Symbol ARAF
Protein Name v-raf murine sarcoma 3611 viral oncogene homolog
Synonyms A-RAF|ARAF1|PKS2|RAFA1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content MAP kinases (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082028 IRAL005B04 pOTB7 BC002466 NM_001654 Full
HGY084102 IRAL010E06 pOTB7 BC007514 NM_001654 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179745 ARi49G01 pGCAP10 NM_001654.2  
GGAGAGGCCCAAGATGGAGACGGCGGCGGCTGTAGCGGCGTGACAGGAGCCCCATGGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl