Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APRT

Gene ID (NCBI) 353
Gene Symbol APRT
Protein Name adenine phosphoribosyltransferase
Synonyms AMP|APRTD
Databases KEGG hsa:353 |  NCBI Gene 353
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00759)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175207 ARi38A07 pGCAP10 NM_000485.2  
GGTCCCCGCGCAGGCGCGCTCGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACT
HKR243772 ARiS109H04 pGCAP10 NM_000485.2  
GGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGAT
HKR331375 RBb28H07 pGCAP1 NM_000485.2  
GGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCG
HKR333351 RBb33G07 pGCAP1 NM_000485.2  
GGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCC
HKR341703 RBb54E07 pGCAP1 NM_000485.2  
GACCCCTCGTGGCGGTCCCGCCCGTCCCCGCGCAGGCGCGCTCGGGCTGCCGCTGGCTCT
HKR378523 RBd46F03 pGCAP10 NM_000485.2  
GGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCC
HKR389212 RBd73A12 pGCAP10 NM_000485.2  
GGCTCGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGT
HKR392177 RBd80H09 pGCAP10 NM_000485.2  
GAGGCGCGCTCGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCA
HKR442168 RBdS105G24 pGCAP10 NM_000485.2  
GGGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGA
HKR461943 RBdS154O07 pGCAP10 NM_000485.2  
GAGGCGCGCTCGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl