Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APP

Gene ID (NCBI) 351
Gene Symbol APP
Protein Name amyloid beta (A4) precursor protein
Synonyms AAA|ABETA|ABPP|AD1|APPI|CTFgamma|CVAP|PN-II|PN2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04520)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01065 pAMC11 Human amyloid precursor 1 cDNA
RDB01066 pAMC23 Human amyloid precursor 2 cDNA
RDB01067 pAMC3.0 Human amyloid precursor 3 cDNA
RDB07692 pGL4-phAPP Promoter collection, Human APP promoter
RDB08714 pTU1-PalphaAPP Plasmid clone to express PalphaAPP chimeric protein in S. cerevisiae

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056261 IRAK140K21 pCMV-SPORT6 BC065529 NM_201413 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017562 W01A043P02 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017570 W01A043P10 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017574 W01A043P14 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017582 W01A043P22 pENTR-TOPO IRAK140K21 BC065529 NM_201413  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041656 ARe04C08 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCC
HKR044035 ARe10B11 pKA1U5 NM_000484.2  
GGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCCGGGTAGACGGCG
HKR044898 ARe12E02 pKA1U5 NM_000484.2  
GGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAGCAAGGACGCGGCGGAT
HKR050498 ARe26E02 pKA1U5 NM_000484.2  
GGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGG
HKR054572 ARe36H04 pKA1U5 NM_000484.2  
GGGAGGAGCGTGCGCGGGGGCCCCGGGAGACNCCTTNAGTGGCGGCGCGGGCAGAGCAAG
HKR060504 ARe51E08 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCC
HKR066427 ARe66B03 pKA1U5 NM_000484.2  
GCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGG
HKR070826 ARe77B02 pKA1U5 NM_000484.2  
GAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGNGCNCCGGGAGACGGCGGCGGTGGCGGC
HKR072801 ARe82A01 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCG
HKR074102 ARe85E06 pKA1U5 NM_000484.2  
ATCCTGAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCC
HKR205508 ARiS013M20 pGCAP10 NM_000484.2  
GGAGAGCACGCGGAGGANCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.24

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl