DNA Bank Top |  KEGG KO K04520 > 

RIKEN DNA Bank Human Resource - APP

Gene ID NCBI Gene 351 |  KEGG hsa:351
Gene Symbol APP
Protein Name amyloid beta precursor protein
Synonyms AAA|ABETA|ABPP|AD1|APPI|CTFgamma|CVAP|PN-II|PN2|alpha-sAPP|preA4
Featured content Alzheimer disease - human

Link

Ortholog resource in our bank

  APP


External database

human APP

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB08714 pTU1-PalphaAPP Plasmid clone to express PalphaAPP chimeric protein in S. cerevisiae    
RDB07692 pGL4-phAPP Promoter collection, Human APP promoter    
RDB01067 pAMC3.0 Human amyloid precursor 3 cDNA    
RDB01066 pAMC23 Human amyloid precursor 2 cDNA    
RDB01065 pAMC11 Human amyloid precursor 1 cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056261 IRAK140K21 pCMV-SPORT6 BC065529 NM_201413 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017562 W01A043P02 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017570 W01A043P10 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017574 W01A043P14 pENTR-TOPO IRAK140K21 BC065529 NM_201413  
HGE017582 W01A043P22 pENTR-TOPO IRAK140K21 BC065529 NM_201413  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041656 ARe04C08 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCC
HKR044035 ARe10B11 pKA1U5 NM_000484.2  
GGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCCGGGTAGACGGCG
HKR044898 ARe12E02 pKA1U5 NM_000484.2  
GGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAGCAAGGACGCGGCGGAT
HKR050498 ARe26E02 pKA1U5 NM_000484.2  
GGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGG
HKR054572 ARe36H04 pKA1U5 NM_000484.2  
GGGAGGAGCGTGCGCGGGGGCCCCGGGAGACNCCTTNAGTGGCGGCGCGGGCAGAGCAAG
HKR060504 ARe51E08 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGTAGGAGCGTGCGCGGGGGCCCC
HKR066427 ARe66B03 pKA1U5 NM_000484.2  
GCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGG
HKR070826 ARe77B02 pKA1U5 NM_000484.2  
GAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGNGCNCCGGGAGACGGCGGCGGTGGCGGC
HKR072801 ARe82A01 pKA1U5 NM_000484.2  
GGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCG
HKR074102 ARe85E06 pKA1U5 NM_000484.2  
ATCCTGAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGGGGGCCC
HKR205508 ARiS013M20 pGCAP10 NM_000484.2  
GGAGAGCACGCGGAGGANCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl