Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APLP2

Gene ID (NCBI) 334
Gene Symbol APLP2
Protein Name amyloid beta (A4) precursor-like protein 2
Synonyms APLP-2|APPH|APPL2|CDEBP
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08117)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080450 IRAL001C02 pOTB7 BC000373 NM_001642 Full/var
HGY085336 IRAL013F16 pOTB7 BC004371 NM_001642 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167307 ARi18E11 pGCAP10 NM_001642.2  
GAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCC
HKR074502 ARe86E06 pKA1U5 NM_001642.2  
GAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCC
HKR078081 ARe95D09 pKA1U5 NM_001642.2  
GAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCC
HKR078482 ARe96D10 pKA1U5 NM_001642.2  
GCCCCGGGGCGGCGGCGAACTGGCTTTAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGG
HKR205340 ARiS013F20 pGCAP10 NM_001642.2  
GAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCC
HKR219880 ARiS049L16 pGCAP10 NM_001642.2  
GGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCCGCGCGCTAGAGCGACCCG
HKR247571 ARiS118P11 pGCAP10 NM_001642.2  
GGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCCGCGC
HKR277695 ARiS194D23 pGCAP10 NM_001642.2  
GAGATGCTTCTGGGTCNCGNTGTGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCC
HKR279510 ARiS198M22 pGCAP10 NM_001642.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl