Prev. |  KEGG KO K08731 > 

RIKEN DNA Bank Human Resource - BIRC5

Gene ID NCBI Gene 332 |  KEGG hsa:332
Gene Symbol BIRC5
Protein Name baculoviral IAP repeat containing 5
Synonyms API4|EPR-1
Featured content Hippo signaling (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  BIRC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03521 pAxCALNLhBIRC5 (forward) Shuttle vector to generate rAd harboring human BIRC5 (forward)
RDB05070 pAxCALNLhBIRC5(forward) Shuttle vector to generate rAd expressing human BIRC5
RDB05071 pAxCALNLhBIRC5(reverse) Shuttle vector to generate rAd expressing human BIRC5
RDB05072 pAxCALNLhBIRC5(forward) Shuttle vector to generate rAd expressing human BIRC5
RDB05073 pAxCALNLhBIRC5(reverse) Shuttle vector to generate rAd expressing human BIRC5
RDB05398 pAxCALNLhBIRC5 (forward) Shuttle vector to generate rAd harboring human BIRC5 (forward)
RDB05399 pAxCALNLhBIRC5 (reverse) Shuttle vector to generate rAd harboring human BIRC5 (reverse)
RDB06597 pCMFlag_hsBIRC5 Expression vector of human BIRC5/API4.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080671 IRAL001L07 pOTB7 BC008718 NM_001168 Full/var
HGY082858 IRAL007C10 pOTB7 BC000784 NM_001012270 Full
HGY096589 IRAL041H21 pDNR-LIB BC034148 NM_001168 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060169 ARe50H01 pKA1U5 NM_001168.2  
TGAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATC
HKR320949 RBb02G05 pKA1U5 NM_001168.2  
GAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGTNNGTGGCGGCGGCGGCATGGGTG
HKR361202 RBd03A02 pGCAP10 NM_001168.2  
GAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACG
HKR361346 RBd03G02 pGCAP10 NM_001168.2  
GGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTT
HKR392548 RBd81G04 pGCAP10 NM_001168.2  
GCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGC
HKR405227 RBdS013B03 pGCAP10 NM_001168.2  
GGCCAGATTTGAATCGCCGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl