Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BIRC5

Gene ID (NCBI) 332
Gene Symbol BIRC5
Protein Name baculoviral IAP repeat containing 5
Synonyms API4|EPR-1
Databases KEGG hsa:332 |  NCBI Gene 332
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08731)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03521 pAxCALNLhBIRC5 (forward) Shuttle vector to generate rAd harboring human BIRC5 (forward)
RDB05070 pAxCALNLhBIRC5(forward) Shuttle vector to generate rAd expressing human BIRC5
RDB05071 pAxCALNLhBIRC5(reverse) Shuttle vector to generate rAd expressing human BIRC5
RDB05072 pAxCALNLhBIRC5(forward) Shuttle vector to generate rAd expressing human BIRC5
RDB05073 pAxCALNLhBIRC5(reverse) Shuttle vector to generate rAd expressing human BIRC5
RDB05398 pAxCALNLhBIRC5 (forward) Shuttle vector to generate rAd harboring human BIRC5 (forward)
RDB05399 pAxCALNLhBIRC5 (reverse) Shuttle vector to generate rAd harboring human BIRC5 (reverse)
RDB06597 pCMFlag_hsBIRC5 Expression vector of human BIRC5/API4

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080671 IRAL001L07 pOTB7 BC008718 NM_001168 Full/var
HGY096589 IRAL041H21 pDNR-LIB BC034148 NM_001168 Full/var
HGY082858 IRAL007C10 pOTB7 BC000784 NM_001012270 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060169 ARe50H01 pKA1U5 NM_001168.2  
TGAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATC
HKR320949 RBb02G05 pKA1U5 NM_001168.2  
GAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGTNNGTGGCGGCGGCGGCATGGGTG
HKR361202 RBd03A02 pGCAP10 NM_001168.2  
GAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACG
HKR361346 RBd03G02 pGCAP10 NM_001168.2  
GGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTT
HKR392548 RBd81G04 pGCAP10 NM_001168.2  
GCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGC
HKR405227 RBdS013B03 pGCAP10 NM_001168.2  
GGCCAGATTTGAATCGCCGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl