Prev. |  KEGG KO K16060 > 

RIKEN DNA Bank Human Resource - BIRC2

Gene ID NCBI Gene 329 |  KEGG hsa:329
Gene Symbol BIRC2
Protein Name baculoviral IAP repeat containing 2
Synonyms API1|HIAP2|Hiap-2|MIHB|RNF48|c-IAP1|cIAP1
Featured content Hippo signaling (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  BIRC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006093 IRAK015D21 pCMV-SPORT6 BC016174 NM_001166 Full
HGY013829 IRAK034J13 pBluescriptR BC028578 NM_001166 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008216 W01A020I24 pENTR-TOPO IRAK015D21 BC016174 NM_001166  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050854 ARe27C06 pKA1U5 NM_001166.3  
TGGTGCGTCAGAGTGAGCCCGGATGGGGCGGCGGGCTTCGGGAGCGCCCGGGCTGATCCG
HKR068122 ARe70F02 pKA1U5 NM_001166.3  
GGGGGCGGCGGGCTTCGGGAGCGCCCGGGCTGATCCGAGCCGAGCGGGCCGTATCTCCTT
HKR078455 ARe96C07 pKA1U5 NM_001166.3  
GGCGTCAGAGTGAGCCCGGATGGGGCGGCGGGCTTCGGGAGCGCCCGGGCTGATCCGAGC
HKR234905 ARiS087E09 pGCAP10 NM_001166.3  
GGGGCTGATCCGAGCCGAGCGGGCCGTATCTCCTTGTCGGCGCCGCTGATTCCCGGCTCT
HKR380473 RBd51D01 pGCAP10 NM_001166.3  
GGTCAGAGTGAGCCCGGATGGGGCGGCGGGCTTCGGGAGCGCCCGGGCTGATCCGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl