Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APEX1

Gene ID (NCBI) 328
Gene Symbol APEX1
Protein Name APEX nuclease (multifunctional DNA repair enzyme) 1
Synonyms APE|APE1|APEN|APEX|APX|HAP1|REF1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10771)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07729 pGL4-phAPEX1 Promoter collection, Human APEX1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005041 IRAK012K01 pCMV-SPORT6 BC008145 NM_080649 Full/var
HGY080417 IRAL001A17 pOTB7 BC002338 NM_080649 Full/var
HGY083618 IRAL009A18 pOTB7 BC019291 NM_080649 Full/var
HGY083962 IRAL009P02 pOTB7 BC004979 NM_080649 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021604 W01A054A04 pENTR-TOPO flj0053m12 AK098588 NM_080649  
HGE021608 W01A054A08 pENTR-TOPO flj0053m12 AK098588 NM_080649  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051325 ARe28F05 pKA1U5 NM_001641.2  
GGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCT
HKR068926 ARe72F06 pKA1U5 NM_001641.2  
GAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTC
HKR070858 ARe77C10 pKA1U5 NM_001641.2  
GCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGNCTGCCATCGGGCCGGTGCAGATACGGG
HKR235027 ARiS087J11 pGCAP10 NM_001641.2  
AGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAG
HKR243925 ARiS109N13 pGCAP10 NM_001641.2  
GGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCT
HKR328125 RBb20F05 pKA1U5 NM_001641.2  
GGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCA
HKR370401 RBd26A01 pGCAP10 NM_001641.2  
AGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGC
HKR370803 RBd27A03 pGCAP10 NM_001641.2  
GGTCTTCTCCCCAGCCTTAGCTGGTTTCATGATTTCTTTGCGTCTGTAGGCAACGCGGTA
HKR372030 RBd30B06 pGCAP10 NM_001641.2  
GTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGT
HKR378156 RBd45G12 pGCAP10 NM_001641.2  
GAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGC
HKR392145 RBd80G01 pGCAP10 NM_001641.2  
GAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAA
HKR399274 RBd98D02 pGCAP10 NM_001641.2  
GGTTCCGCTTCAAGGGGCGGTGCACAGGCGGGCCGAAGATGGAGTTGGGAAGTTGCCTGG
HKR432404 RBdS081A04 pGCAP10 NM_001641.2  
GAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl